Genetic Mechanisms
Contents
Genetic Mechanisms¶
Why?
Genes exert their effects on behavior via the proteins and protein expression that they encode. Importantly, behavior is a complex trait effected by many genes in concert, which has implications for how the genetic mechanisms of behavior are studied.
Genetics Primer¶
Just to remind you of the sorts of molecules we are thinking about today.
Proteins¶
The proteins comprising an animal’s body are essential material to all behavioral phenotypes. Proteins provide the physical form of an animal, which grants unique affordances to different animals. Proteins also dictate the functional properties of an animal’s nervous system, which orchestrates the actions of behavior directly.
Central Dogma¶
The following deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and amino acid (AA) (single letter code) sequences are from the NCBI GenBank. Each letter represents an individual molecule.
The DNA gene for the acetylcholine receptor alpha-1 subunit (length 1449 characters)
ATGGAGCCCTGGCCTCTCCTCCTGCTCTTTAGCCTTTGCTCAGCTGGCCTCGTCCTGGGCTCCGAACATGAGACCCGTCTGGTGGCAAAGCTATTTAAAGACTACAGCAGCGTGGTGCGGCCAGTGGAAGACCACCGCCAGGTCGTGGAGGTCACCGTGGGCCTGCAGCTGATACAGCTCATCAATGTGGATGAAGTAAATCAGATCGTGACAACCAATGTGCGTCTGAAACAGGGTGACATGGTAGATCTGCCACGCCCCAGCTGCGTGACTTTGGGAGTTCCTTTGTTTTCTCATCTGCAGAATGAGCAATGGGTGGATTACAACCTAAAATGGAATCCAGATGACTATGGCGGTGTGAAAAAAATTCACATTCCTTCAGAAAAGATCTGGCGCCCAGACCTTGTTCTCTATAACAATGCAGATGGTGACTTTGCTATTGTCAAGTTCACCAAAGTGCTCCTGCAGTACACTGGCCACATCACGTGGACACCTCCAGCCATCTTTAAAAGCTACTGTGAGATCATCGTCACCCACTTTCCCTTTGATGAACAGAACTGCAGCATGAAGCTGGGCACCTGGACCTACGACGGCTCTGTCGTGGCCATCAACCCGGAAAGCGACCAGCCAGACCTGAGCAACTTCATGGAGAGCGGGGAGTGGGTGATCAAGGAGTCCCGGGGCTGGAAGCACTCCGTGACCTATTCCTGCTGCCCCGACACCCCCTACCTGGACATCACCTACCACTTCGTCATGCAGCGCCTGCCCCTCTACTTCATCGTCAACGTCATCATCCCCTGCCTGCTCTTCTCCTTCTTAACTGGCCTGGTATTCTACCTGCCCACAGACTCAGGGGAGAAGATGACTCTGAGCATCTCTGTCTTACTGTCTTTGACTGTGTTCCTTCTGGTCATCGTGGAGCTGATCCCCTCCACGTCCAGTGCTGTGCCCTTGATTGGAAAATACATGCTGTTCACCATGGTGTTCGTCATTGCCTCCATCATCATCACTGTCATCGTCATCAACACACACCACCGCTCACCCAGCACCCATGTCATGCCCAACTGGGTGCGGAAGGTTTTTATCGACACTATCCCAAATATCATGTTTTTCTCCACAATGAAAAGACCATCCAGAGAAAAGCAAGACAAAAAGATTTTTACAGAAGACATTGATATCTCTGACATTTCTGGAAAGCCAGGGCCTCCACCCATGGGCTTCCACTCTCCCCTGATCAAACACCCCGAGGTGAAAAGTGCCATCGAGGGCATCAAGTACATCGCAGAGACCATGAAGTCAGACCAGGAGTCTAACAATGCGGCGGCAGAGTGGAAGTACGTTGCAATGGTGATGGACCACATACTCCTCGGAGTCTTCATGCTTGTTTGCATCATCGGAACCCTAGCCGTGTTTGCAGGTCGACTCATTGAATTAAATCAGCAAGGATGA
The transcribed mRNA for the acetylcholine receptor alpha-1 subunit (length 1449 characters)
AUGGAGCCCUGGCCUCUCCUCCUGCUCUUUAGCCUUUGCUCAGCUGGCCUCGUCCUGGGCUCCGAACAUGAGACCCGUCUGGUGGCAAAGCUAUUUAAAGACUACAGCAGCGUGGUGCGGCCAGUGGAAGACCACCGCCAGGUCGUGGAGGUCACCGUGGGCCUGCAGCUGAUACAGCUCAUCAAUGUGGAUGAAGUAAAUCAGAUCGUGACAACCAAUGUGCGUCUGAAACAGGGUGACAUGGUAGAUCUGCCACGCCCCAGCUGCGUGACUUUGGGAGUUCCUUUGUUUUCUCAUCUGCAGAAUGAGCAAUGGGUGGAUUACAACCUAAAAUGGAAUCCAGAUGACUAUGGCGGUGUGAAAAAAAUUCACAUUCCUUCAGAAAAGAUCUGGCGCCCAGACCUUGUUCUCUAUAACAAUGCAGAUGGUGACUUUGCUAUUGUCAAGUUCACCAAAGUGCUCCUGCAGUACACUGGCCACAUCACGUGGACACCUCCAGCCAUCUUUAAAAGCUACUGUGAGAUCAUCGUCACCCACUUUCCCUUUGAUGAACAGAACUGCAGCAUGAAGCUGGGCACCUGGACCUACGACGGCUCUGUCGUGGCCAUCAACCCGGAAAGCGACCAGCCAGACCUGAGCAACUUCAUGGAGAGCGGGGAGUGGGUGAUCAAGGAGUCCCGGGGCUGGAAGCACUCCGUGACCUAUUCCUGCUGCCCCGACACCCCCUACCUGGACAUCACCUACCACUUCGUCAUGCAGCGCCUGCCCCUCUACUUCAUCGUCAACGUCAUCAUCCCCUGCCUGCUCUUCUCCUUCUUAACUGGCCUGGUAUUCUACCUGCCCACAGACUCAGGGGAGAAGAUGACUCUGAGCAUCUCUGUCUUACUGUCUUUGACUGUGUUCCUUCUGGUCAUCGUGGAGCUGAUCCCCUCCACGUCCAGUGCUGUGCCCUUGAUUGGAAAAUACAUGCUGUUCACCAUGGUGUUCGUCAUUGCCUCCAUCAUCAUCACUGUCAUCGUCAUCAACACACACCACCGCUCACCCAGCACCCAUGUCAUGCCCAACUGGGUGCGGAAGGUUUUUAUCGACACUAUCCCAAAUAUCAUGUUUUUCUCCACAAUGAAAAGACCAUCCAGAGAAAAGCAAGACAAAAAGAUUUUUACAGAAGACAUUGAUAUCUCUGACAUUUCUGGAAAGCCAGGGCCUCCACCCAUGGGCUUCCACUCUCCCCUGAUCAAACACCCCGAGGUGAAAAGUGCCAUCGAGGGCAUCAAGUACAUCGCAGAGACCAUGAAGUCAGACCAGGAGUCUAACAAUGCGGCGGCAGAGUGGAAGUACGUUGCAAUGGUGAUGGACCACAUACUCCUCGGAGUCUUCAUGCUUGUUUGCAUCAUCGGAACCCUAGCCGUGUUUGCAGGUCGACUCAUUGAAUUAAAUCAGCAAGGAUGA
The translated protein for the acetylcholine receptor alpha-1 subunit (length 483 characters)
MEPWPLLLLFSLCSAGLVLGSEHETRLVAKLFKDYSSVVRPVEDHRQVVEVTVGLQLIQLINVDEVNQIVTTNVRLKQGDMVDLPRPSCVTLGVPLFSHLQNEQWVDYNLKWNPDDYGGVKKIHIPSEKIWRPDLVLYNNADGDFAIVKFTKVLLQYTGHITWTPPAIFKSYCEIIVTHFPFDEQNCSMKLGTWTYDGSVVAINPESDQPDLSNFMESGEWVIKESRGWKHSVTYSCCPDTPYLDITYHFVMQRLPLYFIVNVIIPCLLFSFLTGLVFYLPTDSGEKMTLSISVLLSLTVFLLVIVELIPSTSSAVPLIGKYMLFTMVFVIASIIITVIVINTHHRSPSTHVMPNWVRKVFIDTIPNIMFFSTMKRPSREKQDKKIFTEDIDISDISGKPGPPPMGFHSPLIKHPEVKSAIEGIKYIAETMKSDQESNNAAAEWKYVAMVMDHILLGVFMLVCIIGTLAVFAGRLIELNQQG
The mRNA sequence is a copy of the DNA sequence (with a slight modification of bases). Ribosomes in the cell cytoplasm read out mRNA and, based on mRNA sequence, construct a string of amino acid chains that make up the synthesized protein. Therefore, genes ultimately “code for” protein structure.
Sexual Reproduction: mixing things up¶
An animal’s behavior is comprised of many phenotypes. For example, one person might: participate in a lot of sports, spend a lot of their time socializing with other people, and read a lot; while another person might: not do any sports, spend most of their time alone, and write a lot. Let’s consider that these two people mated. If all of their offspring were either “just like one parent” or “just like the other parent”, then it might infer that the genes underlying all three of these behaviors are linked.
- genetic linkage¶
the tendency of DNA sequences that are close together on a chromosome to be inherited together during the meiosis phase of sexual reproduction.
In animal behavior, we often think of multi-trait phenotypes as personalities or syndromes. The ability of traits to be correlated with each other depends on the mechanisms of heritability and sexual reproduction.
Independent Assortment¶
In sexual reproduction, gametes are produced from the genome of a parent. For each chromosome (DNA strand), each gamete carries one of the two parental versions. During meiosis (before the pairs of parental chromosomes are reduced to individual chromosomes), chromosome pairs line up with random orientation across the midline. Therefore, genes on separate chromosomes assort independently - ie. they get randomly mixed up. Importantly, independent assortment results in suites of traits that are uncorrelated across individuals (in otherwords, individuals each get a random mix of phenotype possibilities… at least for phenotypes controlled by genes on separate chromosomes).
Recombination¶
Even genes on the same chromosome can get mixed up. At the very beginning of meiosis, homologous chromosomes randomly exchange matching fragments of DNA during crossover events.
Independent assortment and recombination both contribute the the genetic variation among offspring from a parental generation (ie, compare the resulting allele composition of gametes between Figure 55 and 56).
Gene-Phenotype Trends¶
The biochemistry of heritability through sexual reproduction leads to relationships between:
the number of genes (or linked genes) and the distribution of phenotypes
genetic linkage and correlations among different phenotypes
These two predictable associations scaffold popular approaches to studying the genetic mechanisms of animal behavior. Figure 57 shows these relationships in more detail.
⏳ 10 min
In Figure 57, ‘linked’ means that the genes (letters) on the same chromosome (gray bars) do not get separated during recombination (crossover events).
Q1: How many total potential gamete allele combinations are there for genotype pattern #3?
Q2: In a population with a high correlation between traits X and Y, you would expect which of the following sets of phenotypes:
1. Individuals with long deep tunnels and individuals with short shallow tunnels
2. Individuals with long deep tunnels, individuals with short shallow tunnels, individuals with long shallow tunnels, and individuals with short deep tunnels
Q3: Based on the data for genotype pattern #4, which gene(s) (A, B, R) would you conclude coded for behaviors X, which genes for Y, and which genes for Z? What is the evidence?
Q4: When behavioral traits are genetically linked, it [ DECREASES / INCREASES ] the number of different possible behavioral phenotypes in the population? (choose one)
⏸️ PAUSE here for class-wide discussion
Note… when increase the number of possible phenotype combinations among many traits, the variance often overlaps and the resulting distribution looks unimodal, but flat/broad.
Experimental Approaches¶
You have already examined the phylogeny of burrowing behavior among Peromyscus (margin Figure).
Now, let’s examine some genetic mechanistic questions. Ultimately, we want to identify genes that control burrowing behavior (ie. what genes explain phenotype variation in the behavior across animals/species). But first, we need to know if genes control the behavior at all. In other words, are burrowing behavior phenotypes inherited genetically or learned culturally? Research using P. maniculatus and P. polionotus provide a great example of how to investigate these questions2.
Genes?¶
Cross Fostering¶
To cross-foster animals, you rear offspring from animals exhibiting one phenotype for a trait with parents exhibiting another phenotype. The phenotype of cross-fostered offspring are then compared with the phenotype of offspring raised by biological parents. Cross-fostering experiments isolate pre-natal from post-natal factors effecting behavior.
⏳ 10 min
Q5: What two metrics were used to quantify the behavioral phenotypes?
Q6: Based on the data in Figure 63, you would conclude that burrowing behavior is [ GENETICALLY INHERITED / CULTURALLY LEARNED ] (Select one answer choice). What evidence supports your conclusion?
Q7: What “proportion digging escape tunnel” results would you predict under the alternate hypothesis to Q6)
⏸️ PAUSE here for class-wide discussion
What Genes?¶
Once it has been determined that a behavior is inherited, there are three commonly used methods for investigating what genes control it: genetic cross, forward genetics, reverse genetics.
1: Genetic Cross¶
Genetic crosses afford powerful insight into the genetic basis of phenotypic variation (as you examined in Figure 61). Phenotype heritability patterns are a useful tool for inferring the number of and relationship among genes contributing to complex behavioral phenotyps.
Burrowing behavior has diverged significantly between two interfertile sister species, P. maniculatus and P. polionotus. Because they are interfertile, they can be genetically crossed (ie. mated).
⏳ 15 min
Examine the results of this genetic cross experiment to draw conclusions about the genetic architecture of burrowing behavior.
Q8: Based on the data in Figure 61, the phenotypic variation in burrowing behavior among the BC generation is [ GREATER / LESS ] the parental generation? (select one choice)
Q9: Based on the data in Figure 61, would you conclude that burrowing behavior has a monogenic or polygenic architecture? Use the model in Figure 57 to explain your reasoning.
Table 1: Correlations in backcross mice among two measures of entrance tunnel length (max and average) and the presence of an escape tunnel, where -1: anticorrelated, 0: uncorrelated, and 1: positively correlated
Trait |
Escape Presence |
Max Entrance |
---|---|---|
Max Entrance |
0.29 |
|
Avg Entrance |
0.23 |
0.94 |
Q10: Based on the results in Table 1, would you conclude that tunnel length and the presence of an escape behavior are orchestrated by linked or unlinked genes? Use the model in Figure 57 to explain your reasoning.
⏸️ PAUSE here for class-wide discussion
2: Forward Genetics¶
The identification of genomic regions associated with behavioral phenotypes is a first step in the identification of causal genes responsible for variation in a naturally evolved, complex behavior.
Gregor Mendel was either clever or lucky enough to study traits of simple inheritance in his pea plants; however, many phenotypes of interest to modern geneticists are complex (quantitative). Understanding the genetic basis of quantitative traits requires a combination of modern molecular genetic techniques and powerful statistical methods.
Quantitative Trait Locus (QTL) mapping is a widely used statistical tool for this purpose. QTL mapping simply involves finding an association between a genetic marker and a phenotype that can be measured. The genetic marker contains information about which parental genome that section of chromosome came from.
To localize the causal regions for burrowing behavior in the genome, hybrid animals from a large genetic cross of P. maniculatus and P. polionotus were assayed for burrowing behavior and then genotyped. QTL mapping techniques were used to identify regions that explain phenotypic variation in the hybrid animals.
Q11: If a chromosomal region is a “QTL” for a behavior, then differences in the __________ at that region, will likely cause differences in ____________.
Q12: The results of QTL mapping provides information about whether genes that control a behavior are linked or not. (TRUE or FALSE? Why / why not?)
Q13: LG 5 is not a QTL for entrance tunnel length. What would the results plot look like for entrance tunnel length as a function of LG 5 genotype?
⏸️ PAUSE here for class-wide discussion
After narrowing down a chromosomal region that explains some fraction of pheontypic variation, genetic sequencing is then a necessary (and difficult) step to understand how specific sequence changes cause behavioral changes.
3: Reverse Genetics¶
For a long time, it was thought that animal behaviors are too complex to be immediately determined by genetic factors. For example, male courtship behavior in Drosophila is a stereotyped sequence of FAPs in which a male follows a female, taps the female, sings a song by vibrating one wing, licks the female’s genitalia and curls the abdomen to attempt copulation. Male courtship behavior is obviously complex, however, it was one of the first behaviors found to be specified by a single gene.
Using a reverse genetic approach, Demir and Diskson (2005)6 showed that the fruitless gene is transcribed and translated differently in male and female flies. For a reverse genetic approach, they manipulated the genome directly. Splicing the fruitless gene in a “male” way (ie. a targeted manipulation of the suspected gene of interest), induced male courtship behavior in female flies. Male homozygous fruitless mutants had normal genitalia but did not exhibit courtship behavior toward female flies.
Even though many behaviors are polygenic (effected by multiple genes), a reverse genetic approach can still yield insight.
Case Study: Genetics of Monogamy¶
Monogamy and promiscuity are two common phenotypes for mating behavior.
Thomas Insel, head of the National Institute of Mental Health and a pioneer in vole studies, describes voles as “an extraordinary gift to science” in which nature has performed an experiment with which we can ask the question: “what was modified genetically in the brain to get this difference in behavior?” In this case, mating behavior. Unlike most rodents, many voles are monogamous, forming bonds that last long after mating (often for life) and cohabitating more or less permanently in subterranean dens. Prarie voles are one of these robustly monogamous species. Interestingly, prairie voles have near-identical cousins called montane voles that do not form social bonds after mating.
The results of one of the first genetic experiments in montane and prarie voles are shown in Figure 69.
Young et al 1999 7 did not find differences in the protein sequence of the V1a receptor gene. Instead, they found differences in the “microsatellite repeats” in the region of the genome read before the gene itself gets read. Although the V1a-R protein iteself is nearly identical between these two species, the protein ends up located in different parts of the brain. Microsatellite repeats do not effect the structure of a protein, but rather regulate where and when it is expressed (transcribed and translated).
We can return to this example when we talk about mating behavior.
Additional Resources¶
Proteins from PDB-101
Take an interactive tour of molecular machinery on the protein databank
Robert Plomin, Michael J. Owen and Peter McGuffin (1994) The Genetic Basis of Complex Human Behaviors Science, Vol. 264, No. 5166
Life in a genetic basis of behavior lab: Nature and Nurture podcast Hopi Hoekstra
- 1(1,2)
- 2
Several features of Peromyscus burrowing behavior make it a well-suited system for tackling how genetic change leads to complex behavioral change.
Burrowing behavior is largely innate.
A burrow is a behavioral product (“extended phenotype”) that can be measured like a morphological trait.
Burrowing behavior has diverged significantly between two interfertile sister species, P. maniculatus and P. polionotus.
- 3(1,2)
Hu, C. K., & Hoekstra, H. E. (2017). Peromyscus burrowing: A model system for behavioral evolution. Seminars in cell & developmental biology, 61, 107–114. https://doi.org/10.1016/j.semcdb.2016.08.001
- 4(1,2)
- 5
- 6
- 7(1,2)
Young, L., Nilsen, R., Waymire, K. et al. Increased affiliative response to vasopressin in mice expressing the V1a receptor from a monogamous vole. Nature 400, 766–768 (1999).